DNA Challenge!

DNA:    CAGTTACCATGAGCTGCTTACGCATGTAACTGAACGCATCTAAG


I hope this was prepared right! It was a bit of a challenge, and even with my glasses on I hope everything matches up! This is like the Da Vinci Code.... just waiting to be cracked! 

First Blog Post

This is the first blog post that I've ever done! I wasn't to sure if we were supposed to keep the assignment numbered, but I'm excited to read everyone else's blogs!!

Challenging Beliefs from Jean-Baptiste Lamarck to Charles Darwin

1. Jean-Baptiste Lamarck I would strongly suggest had a huge influence on Darwin.

2. The contribution Lamarck is most commonly known for is “inheritance of acquired traits” and Organisms driven to greater complexity, the perfection that species reach over time, which I would personally reference as natural selection-but this wasn’t Lamarck’s main focus. Evolutionists acknowledged him as a “great zoologist and as a forerunner of evolution”. After reading more about Lamarck, I found his story rather sad. It mentioned that Lamarck had died in poverty and obscurity; how could a man with ideas that challenged everyone’s beliefs in society, die in this manner? Well, that’s exactly it; he challenged everyone’s beliefs.  The word "invertebrates" did not even exist at the time; Lamarck coined it.

3. The most accurate points from “How does evolution work?” that relate to Lamarck would be:

¤If the environment changes, the traits that are helpful or adaptive to that environment will be different.

“Nature, in producing in succession every species of animal, and beginning with the least perfect or simplest to end her work with the most perfect, has gradually complicated their structure." Lamarck believes that each species starts from,l ets say “basic” then creates and develops and evolves in a “perfect” form to function in its environment.

¤In order for traits to evolve and change, they MUST be heritable.

This was Lamarck’s main argument. “This rule -- that use or disuse causes structures to enlarge or shrink -- Lamarck called the "First Law" in his book Philosophie zoologique. Lamarck's "Second Law" stated that all such changes were heritable. The result of these laws was the continuous, gradual change of all organisms, as they became adapted to their environments.”

¤Individuals do not evolve. Populations do. Individuals cannot change their heritable traits. This I believe also represents what was written above.

“As Lamarck lectured his students in 1803, after ten years of research on invertebrates: . . . we perceive that, relative to the animal kingdom, we should chiefly devote our attention to the invertebrate animals, because their enormous multiplicity in nature, the singular diversity of their systems of organization, and of their means of multiplication, . . . show us, much better than the higher animals, the true course of nature, and the means which she has used and which she still unceasingly employs to give existence to all the living bodies of which we have knowledge.”

4. After I read question number 4, it made me giggle… for two reasons. Sometimes I feel angst against Charles Darwin. Something I need to personally work on, why do I feel this way? Religion. I am religious, BUT I am so fascinated with what I’m learning that I hope this angst against Darwin disappears. The other reason I giggled was because I felt as though Darwin stole a main concept from Lamarck… the quote is as follows:

“While the mechanism of Lamarckian evolution is quite different from that proposed by Darwin, the predicted result is the same: adaptive change in lineages, ultimately driven by environmental change, over long periods of time. It is interesting to note that Lamarck cited in support of his theory of evolution many of the same lines of evidence that Darwin was to use in the Origin of Species.”

I feel bad that we recognize Darwin for so many innovative ways of thinking, and yet men in the past have had similar ideas and they get the bad end of the stick and Darwin is this fabulous philosopher/scientist. (I already know I may get backlash for this-but I am curious to hear what other people who do believe in evolution have to say!)

5. From the research I did, I found lots about the church that fought against Darwin’s views, and rightfully so. He challenged everything they stood for, everything they taught and learned, the unknown is scary to people, even when there’s proof or not. I also did find a very interesting article on Darwin and the Church’s apology to him, found at: http://www.dailytelegraph.com.au/news/indepth/church-apologises-to-charles-darwin-over-theory-of-evolution/story-e6frewsr-1111117484124. It was said that John-Baptiste Lamarck questioned his faith when he took his first trip on the voyage of the beagle. Darwin had his reservations about evolution, and I believe with him wanting to become part of the Clergy, also offended the church a thousand times more then if he was just “an average man”. I also believe that with having such a deep passion for religion but also for his studies, really made him “triple clarify” every bit of research he did to be sure what he would publish would be true. 

Works Cited:

http://www.ucmp.berkeley.edu/history/lamarck.html

http://evolution.berkeley.edu/evolibrary/article/history_09