Homologous and Analogous Traits

Homologous Traits:
Human’s and Dolphin possess the same Homologous trait... their hands and their fins!

                                                                                      

Many scientists in today’s news have branded dolphins as “highly intelligent” mammals. Also, if you have ever visited Sea World and experienced the routines and tricks they perform, you can attest to this! Humans, (being one) I would like to say we’re fairly smart and produce some of the smartest people to ever walk the planet: Albert Einstein, Charles Darwin, Benjamin Franklin, Stephen Hawking and many more!

The purpose of the dolphin fin is to swim under water, which is where Dolphins reside. On the other hand, us humans reside on land, and we use are hands and arms in more ways than just swimming! (although we do swim) We are able to use our phalanges, which gives us a huge advantage (if I may say so) over that of the dolphins… Imagine if they had exposed fingers to use! When comparing the bone structure from human to dolphin we can see the similarities… Both possess: phalanges, carpals, ulnas, radiuses and humerus.

If one goes far enough back, precisely around 95 million years, we will find the common ancestor to dolphins and humans.

Analogous Traits:

Beavers are the clever engineers of the woods. They are classified as a rodent, and are in fact the largest of the rodents! They are herbivores, preferring to eat bark, roots and aquatic plants and the two species can be found in the woods of North America, Europe and Asia. Beavers are also known for their very strong teeth, which are much needed when cutting down trees to build their homes. Unlike the Beaver, Platypus’s are bottom feeders eating anything from larvae, shellfish and worms, which they scoop up in the bill. Unfortunately they were not blessed with the strong teeth of the beaver, they have no teeth, and can only mash their food. Platypus’s are found in Australia and do contain one perk that beavers do not possess… poisonous venom found on the males in sharp stingers on the heels located on the rear feet.  

The beaver and the Platypus are two different species that share one very similar trait… Their tails!

The structure of the tails from both the beaver and the platypus are very similar. Both of these mammals use this to trait to their advantage; for beavers it’s for swimming and building their burrows and dams, for Platypuses it’s for the art of swimming and navigating smoothly under water. These traits evolved independently from one another, and they are of a different species; although the beaver uses his to build, they both use their tails to swim!

Platypus remains of what was believed to be a distant forebear of both the platypus and the echidna—the fossil species Teinolophos—"actually belong to an early platypus, according to scientists who performed an x-ray analysis of a Teinolophos jawbone." (National Geographic) Platypuses originate from the subclass prototheria, All prototherians laid eggs, as did their therapsid ancestors. The only prototherians surviving today are the duck billed platypus and the echidnas.

The beaver family, Castoridae, contains the two living species of beaver and their fossil relatives. But the earliest ancestor that was recorded belonging to the beaver was known as Agnotocastor. Belonging to the sub class Theria, mammals who’s young’s are born alive (not in eggs).

        

DNA Challenge!

DNA:    CAGTTACCATGAGCTGCTTACGCATGTAACTGAACGCATCTAAG


I hope this was prepared right! It was a bit of a challenge, and even with my glasses on I hope everything matches up! This is like the Da Vinci Code.... just waiting to be cracked! 

First Blog Post

This is the first blog post that I've ever done! I wasn't to sure if we were supposed to keep the assignment numbered, but I'm excited to read everyone else's blogs!!

Challenging Beliefs from Jean-Baptiste Lamarck to Charles Darwin

1. Jean-Baptiste Lamarck I would strongly suggest had a huge influence on Darwin.

2. The contribution Lamarck is most commonly known for is “inheritance of acquired traits” and Organisms driven to greater complexity, the perfection that species reach over time, which I would personally reference as natural selection-but this wasn’t Lamarck’s main focus. Evolutionists acknowledged him as a “great zoologist and as a forerunner of evolution”. After reading more about Lamarck, I found his story rather sad. It mentioned that Lamarck had died in poverty and obscurity; how could a man with ideas that challenged everyone’s beliefs in society, die in this manner? Well, that’s exactly it; he challenged everyone’s beliefs.  The word "invertebrates" did not even exist at the time; Lamarck coined it.

3. The most accurate points from “How does evolution work?” that relate to Lamarck would be:

¤If the environment changes, the traits that are helpful or adaptive to that environment will be different.

“Nature, in producing in succession every species of animal, and beginning with the least perfect or simplest to end her work with the most perfect, has gradually complicated their structure." Lamarck believes that each species starts from,l ets say “basic” then creates and develops and evolves in a “perfect” form to function in its environment.

¤In order for traits to evolve and change, they MUST be heritable.

This was Lamarck’s main argument. “This rule -- that use or disuse causes structures to enlarge or shrink -- Lamarck called the "First Law" in his book Philosophie zoologique. Lamarck's "Second Law" stated that all such changes were heritable. The result of these laws was the continuous, gradual change of all organisms, as they became adapted to their environments.”

¤Individuals do not evolve. Populations do. Individuals cannot change their heritable traits. This I believe also represents what was written above.

“As Lamarck lectured his students in 1803, after ten years of research on invertebrates: . . . we perceive that, relative to the animal kingdom, we should chiefly devote our attention to the invertebrate animals, because their enormous multiplicity in nature, the singular diversity of their systems of organization, and of their means of multiplication, . . . show us, much better than the higher animals, the true course of nature, and the means which she has used and which she still unceasingly employs to give existence to all the living bodies of which we have knowledge.”

4. After I read question number 4, it made me giggle… for two reasons. Sometimes I feel angst against Charles Darwin. Something I need to personally work on, why do I feel this way? Religion. I am religious, BUT I am so fascinated with what I’m learning that I hope this angst against Darwin disappears. The other reason I giggled was because I felt as though Darwin stole a main concept from Lamarck… the quote is as follows:

“While the mechanism of Lamarckian evolution is quite different from that proposed by Darwin, the predicted result is the same: adaptive change in lineages, ultimately driven by environmental change, over long periods of time. It is interesting to note that Lamarck cited in support of his theory of evolution many of the same lines of evidence that Darwin was to use in the Origin of Species.”

I feel bad that we recognize Darwin for so many innovative ways of thinking, and yet men in the past have had similar ideas and they get the bad end of the stick and Darwin is this fabulous philosopher/scientist. (I already know I may get backlash for this-but I am curious to hear what other people who do believe in evolution have to say!)

5. From the research I did, I found lots about the church that fought against Darwin’s views, and rightfully so. He challenged everything they stood for, everything they taught and learned, the unknown is scary to people, even when there’s proof or not. I also did find a very interesting article on Darwin and the Church’s apology to him, found at: http://www.dailytelegraph.com.au/news/indepth/church-apologises-to-charles-darwin-over-theory-of-evolution/story-e6frewsr-1111117484124. It was said that John-Baptiste Lamarck questioned his faith when he took his first trip on the voyage of the beagle. Darwin had his reservations about evolution, and I believe with him wanting to become part of the Clergy, also offended the church a thousand times more then if he was just “an average man”. I also believe that with having such a deep passion for religion but also for his studies, really made him “triple clarify” every bit of research he did to be sure what he would publish would be true. 

Works Cited:

http://www.ucmp.berkeley.edu/history/lamarck.html

http://evolution.berkeley.edu/evolibrary/article/history_09